| Detail of Probeset Mtr.11792.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.11792.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC111076 /FEA=mRNA /DEF=similar to UP|O81909 (O81909) T7I23.15 protein, partial (8%) |
| Mapped public sequence ID |
TC111076 |
| Gene Ontology |
GO:0000122 GO:0000175 GO:0000288 GO:0003674 GO:0005515 GO:0005575 GO:0005634 GO:0005737 GO:0006357 GO:0008150 GO:0030015 GO:0051726 |
| KEGG |
K21492 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT53833 |
| Target sequence |
attttgtttaggctagctatctcataacaaaccatgctagactggcatatttatgtactg
ttgatcgatcgttccaacatatgctttttttttttctcattgtaaatgatataattttgt
gaagtgctctttttatcttttaac |