Detail of Probeset Mtr.11859.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.11859.1.S1_s_at
Species Medicago truncatula
Annotation TC111311 /FEA=mRNA /DEF=homologue to UP|NU3C_TOBAC (P06258) NAD(P)H-quinone oxidoreductase chain 3, chloroplast (NAD(P)H dehydrogenase, chain 3) (NADH-plastoquinone oxidoreductase chain 3) , complete
Mapped public sequence ID TC111311
Gene Ontology GO:0008137 GO:0016491 GO:0050136
KEGG K02112 K05574
Transporter 3.D.1 3.D.9 3.D.1.2.1 3.D.9.1.1
Transcription Factor
Mapped unigene in the TRICHOME database CA989819  
Target sequence ggacatttctaataatatcgatctttattcctattttggcatttctgatttctggaattt
tagctccaattagaaaagggccagaaaaactttctagttatgaatctgggatagaaccga
tgggcgatgcttggttacaatttcaaatccgttattatatgtttgctctagtttttgttg
tttttgatgttgaaacagtctttctttacccatgggca