| Detail of Probeset Mtr.11952.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.11952.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC111641 /FEA=mRNA /DEF=similar to UP|Q9FLE2 (Q9FLE2) ATP/GTP-binding protein-like, partial (26%) |
| Mapped public sequence ID |
TC111641 |
| Gene Ontology |
GO:0000398 GO:0003674 GO:0005575 GO:0008150 GO:0002119 GO:0005515 GO:0009792 GO:0040007 GO:0040010 GO:0040015 GO:0040035 |
| KEGG |
K06947 K15921 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT45616 |
| Target sequence |
cagaacctttttccattccctatctccgccgcctccacaaaccctagtctttcacattct
cacccgttcaaaatggcgtatggcggt |
