| Detail of Probeset Mtr.120.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.120.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1788.m00050 /FEA=mRNA /DEF=AY515253.1 59506 58870 mth2-55E21 weakly similar to UP|Q877Q8 (Q877Q8) Hypothetical protein CTC00065 (Hypothetical protein CTC00089) (Hypothetical protein CTC00214) (Hypothetical protein CTC00549) |
| Mapped public sequence ID | 1788.m00050 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | atgttggatgtgatctgctactactactatcttggtatggactacaatgataacttgttg |