| Detail of Probeset Mtr.12369.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.12369.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC94546 /FEA=mRNA /DEF=similar to UP|Q5YJR8 (Q5YJR8) 60S acidic ribosomal protein, complete |
| Mapped public sequence ID | TC94546 |
| Gene Ontology | GO:0003735 GO:0005829 GO:0006414 GO:0022625 |
| KEGG | K02943 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS41066 TCMT42524 BQ159151 |
| Target sequence | gattatcgctgcttacttgttggccgttttgggaggcaaccaatccccttctgcttctga |