Detail of Probeset Mtr.12472.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.12472.1.S1_at
Species Medicago truncatula
Annotation TC94913 /FEA=mRNA /DEF=similar to UP|PRR7_ARATH (Q93WK5) Two-component response regulator-like APRR7 (Pseudo-response regulator 7), partial (13%)
Mapped public sequence ID TC94913
Gene Ontology GO:0004115 GO:0004871 GO:0005622 GO:0006198 GO:0006935 GO:0006970 GO:0007275 GO:0030435 GO:0030587 GO:0031276 GO:0046058 GO:0047555 GO:0051279 GO:0051281
KEGG K03407 K03413
Transporter
Transcription Factor C2C2-CO-like
Mapped unigene in the TRICHOME database N/A
Target sequence agtaagtttttccaagtgcctatatatgttttggtttgagcattttttttcctcattaca
tgctgtaaaagagctactctttctatggcttctaatgggattggtctgcagtgatgtcat
ctcatg