| Detail of Probeset Mtr.12598.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.12598.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC95338 /FEA=mRNA /DEF=similar to UP|VT13_ARATH (Q9LVP9) Vesicle transport v-SNARE 13 (AtVTI13) (Vesicle transport v-SNARE protein VTI13) (Vesicle soluble NSF attachment protein receptor 13), complete |
| Mapped public sequence ID |
TC95338 |
| Gene Ontology |
GO:0005484 GO:0006944 GO:0008021 GO:0008565 GO:0016192 GO:0030136 GO:0031201 GO:0042147 |
| KEGG |
K08493 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT46707 |
| Target sequence |
gatatgtttatattgtgcagtgccggaagcaaatttgaaaatgtttgcttctttaaatat
gtggtctcgtgcgggctttgtcatgtaagtatttcatt |
