Detail of Probeset Mtr.1290.1.S1_x_at in Chip AffyMedicago
Probeset ID Mtr.1290.1.S1_x_at
Species Medicago truncatula
Annotation 1558.m00071 /FEA=mRNA /DEF=AC140914.19 81171 82049 mth2-18h17
Mapped public sequence ID 1558.m00071
Gene Ontology GO:0004497 GO:0005575 GO:0016491 GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0005739 GO:0008233 GO:0032197
KEGG K00140 K00517 K09873 K13663 K15001 K22300
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence atgacgtcgtcagaagcagaagctcatcagaagcaagtgaaatctc