| Detail of Probeset Mtr.13139.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.13139.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC97046 /FEA=mRNA /DEF=similar to GB|AAM65957.1|21594039|AY088420 carbonate dehydratase-like protein {Arabidopsis thaliana;} , partial (36%) |
| Mapped public sequence ID | TC97046 |
| Gene Ontology | GO:0004089 GO:0008152 GO:0015977 GO:0006730 |
| KEGG | K01673 |
| Transporter | 2.A.53 2.A.53.8.1 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT45635 TCMT59961 TCMT59962 |
| Target sequence | aacatattaggattccaacctggtgaagtctttatgatacgtaacattgccaatcttgtg |