Detail of Probeset Mtr.13820.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.13820.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
TC99262 /FEA=mRNA /DEF=similar to UP|Q5VRW6 (Q5VRW6) Band 3 anion transport protein-like, partial (9%) |
Mapped public sequence ID |
TC99262 |
Gene Ontology |
GO:0000324 GO:0005624 GO:0005773 GO:0005886 GO:0006623 GO:0006810 GO:0008509 GO:0018193 GO:0046713 GO:0046714 GO:0046715 |
KEGG |
K06573 |
Transporter |
2.A.31 2.A.31.3.1 2.A.31.3.2 2.A.31.1.1 |
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT51511 AL365619
|
Target sequence |
gacacaattaaatttgacctggaggtgctgtctgaatattacaaattttaggatgcagaa
aaggttttgatttaattgtatcatcctctgaagaggactgctctcacgattcttttgtaa
tcaatcagttaagctt |