Detail of Probeset Mtr.14025.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.14025.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
TC100449 /FEA=mRNA /DEF=homologue to UP|R1AD_ARATH (Q9FKC0) 60S ribosomal protein L13a-4, partial (64%) |
Mapped public sequence ID |
TC100449 |
Gene Ontology |
GO:0003735 GO:0005829 GO:0005840 GO:0006414 GO:0015934 GO:0003674 GO:0005575 GO:0008150 |
KEGG |
K02872 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMS41094 AL387056
TCMT49445 AA660183
|
Target sequence |
atcgagcaaaaatggtgtctggttcaggtatctgcgcaaagagggtggtgatc |