| Detail of Probeset Mtr.14147.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.14147.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|858.m00001 /FEA=mRNA /DEF=Disease resistance protein; NB-ARC; Leucine-rich repeat; AAA ATPase AC135229.30.1 3856 462 mth2-7m14 01/13/05 |
| Mapped public sequence ID | IMGAG|858.m00001 |
| Gene Ontology | GO:0002119 GO:0005737 GO:0007163 GO:0007517 GO:0008543 GO:0016337 GO:0030833 GO:0031152 GO:0031154 GO:0031344 GO:0031589 GO:0040010 GO:0043326 GO:0043327 GO:0045335 GO:0017016 GO:0005575 GO:0008150 |
| KEGG | K01768 K02084 K05768 K06685 K06883 K11454 |
| Transporter | |
| Transcription Factor | LIM WRKY |
| Mapped unigene in the TRICHOME database | AY145085 CX535155 TCMT59106 |
| Target sequence | gattactgcaaagatttggtggtattgcaaactggtatctgtgatattatctcattaaag |