| Detail of Probeset Mtr.14149.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.14149.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1108.m00023 /FEA=mRNA /DEF=Peptidase, metallopeptidases; Peptidase M, neutral zinc metallopeptidases, zinc-binding site; H+-transporting two-sector ATPase, delta (OSCP) subunit; Peptidase M10A and M12B, matrixin and adamalysin AC146588.14.221 96166 |
| Mapped public sequence ID |
IMGAG|1108.m00023 |
| Gene Ontology |
GO:0004222 GO:0005515 GO:0005615 GO:0006508 GO:0008270 GO:0070173 GO:0043231 |
| KEGG |
K01398 K01402 K01417 K07761 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
CA917134 |
| Target sequence |
gaaaccgtgaaaagcgtcttcgcaacagcgtttgcacgatggtcggaggtcaccacgctg
aaattcaccgaaacaacgttatattccggcgctgatattaagatcggattcttcaacggc
gaccatggagacggcgagccgtttgacggaagcttgggaacgctagcgcatgctt |
