| Detail of Probeset Mtr.14184.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.14184.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1109.m00024 /FEA=mRNA /DEF=Annexin; Annexin, type V AC146590.23.241 110317 112854 mth2-145p10 01/13/05 |
| Mapped public sequence ID | IMGAG|1109.m00024 |
| Gene Ontology | GO:0005544 GO:0005575 GO:0005886 GO:0030154 |
| KEGG | K01124 |
| Transporter | 1.A.31 1.A.31.1.1 1.A.31.1.2 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | attttgcaaaggttactgatagctcgcattga |