| Detail of Probeset Mtr.14261.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.14261.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|914.m00012 /FEA=mRNA /DEF=Translation protein SH3-like; KOW; Eukaryotic initiation factor 5A hypusine (eIF-5A) AC137819.19.121 76631 77484 mth2-21i24 01/13/05 |
| Mapped public sequence ID | IMGAG|914.m00012 |
| Gene Ontology | GO:0003723 GO:0003743 GO:0005634 GO:0005642 GO:0005643 GO:0005737 GO:0005829 GO:0006406 GO:0006611 GO:0006913 GO:0006915 GO:0006917 GO:0008283 GO:0008612 GO:0017070 GO:0045948 GO:0047485 |
| KEGG | K03263 |
| Transporter | 1.A.8 1.A.8.11.1 1.A.8.11.2 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | AL389103 TCMT41207 AL388676 |
| Target sequence | tcaacagtttgagtccatggccgatgccggagccttcaaaactttccctcaacaagctgg |