| Detail of Probeset Mtr.14265.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.14265.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|772.m00029 /FEA=mRNA /DEF=Serine/threonine protein kinase; Tyrosine protein kinase; Protein kinase; Protein kinase-like; MAP kinase AC124960.25.281 111633 117230 mth2-26j24 01/13/05 |
| Mapped public sequence ID |
IMGAG|772.m00029 |
| Gene Ontology |
GO:0000751 GO:0004707 GO:0007165 GO:0030587 |
| KEGG |
K00924 K04371 |
| Transporter |
|
| Transcription Factor |
WRKY |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atttgcatatcttgaggagcattatggcaaaggaggaactgttgctccacctgagaggca
acacgcttcttcactgccgagagcgtgtgtgttgtattctgataacacgatgcagaatac
ggctga |
