| Detail of Probeset Mtr.14274.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.14274.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|814.m00024 /FEA=mRNA /DEF=RNA-binding region RNP-1 (RNA recognition motif); RNA recognition motif 2 AC126794.14.241 118941 124865 mth2-24j7 01/13/05 |
| Mapped public sequence ID | IMGAG|814.m00024 |
| Gene Ontology | GO:0003723 GO:0005515 GO:0005634 GO:0005737 GO:0005829 GO:0007127 GO:0030587 GO:0033620 GO:0034064 GO:0045836 GO:0008271 GO:0008272 GO:0016021 |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT44423 |
| Target sequence | tacagccgtaaaactgaagcgaacaccaatggcaatgcggataaa |