| Detail of Probeset Mtr.14274.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.14274.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|814.m00024 /FEA=mRNA /DEF=RNA-binding region RNP-1 (RNA recognition motif); RNA recognition motif 2 AC126794.14.241 118941 124865 mth2-24j7 01/13/05 |
| Mapped public sequence ID |
IMGAG|814.m00024 |
| Gene Ontology |
GO:0003723 GO:0005515 GO:0005634 GO:0005737 GO:0005829 GO:0007127 GO:0030587 GO:0033620 GO:0034064 GO:0045836 GO:0008271 GO:0008272 GO:0016021 |
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT44423 |
| Target sequence |
tacagccgtaaaactgaagcgaacaccaatggcaatgcggataaa |