| Detail of Probeset Mtr.14286.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.14286.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|1002.m00006 /FEA=mRNA /DEF=Small nuclear ribonucleoprotein (Sm protein); Small nuclear-like ribonucleoprotein; snRNP AC141115.22.51 24649 27084 mth2-16b23 01/13/05 |
| Mapped public sequence ID | IMGAG|1002.m00006 |
| Gene Ontology | GO:0005515 GO:0017070 |
| KEGG | K11088 K14878 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT53599 BF634855 TCMT53600 |
| Target sequence | ttaagactgcacaaggccaccctatgttggtggagctgaaaaatggagagacatataacg |