| Detail of Probeset Mtr.14359.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.14359.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1220.m00025 /FEA=mRNA /DEF=LQGC hypothetical protein AC148758.19.241 114580 117054 mth2-50l17 01/13/05 |
| Mapped public sequence ID |
IMGAG|1220.m00025 |
| Gene Ontology |
GO:0005515 GO:0005764 GO:0005768 GO:0005769 GO:0005829 GO:0016020 GO:0043130 GO:0043162 GO:0005575 GO:0005737 GO:0019904 GO:0030141 GO:0046426 |
| KEGG |
K04705 K17578 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT50988 |
| Target sequence |
gaaattgaagttgaggtctatgaattatgtaactctgagaagctttcaaggaggatggga
ataagcgtggattccgaccaagtaggtaatgat |
