| Detail of Probeset Mtr.14362.1.S1_a_at in Chip AffyMedicago |
| Probeset ID |
Mtr.14362.1.S1_a_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|784.m00013 /FEA=mRNA /DEF=Aminoacyl-transfer RNA synthetase, class II; Lysyl-tRNA synthetase, class-2; OB-fold nucleic acid binding; tRNA synthetase, class II (D, K and N); Nucleic acid-binding OB-fold AC125475.11.121 89666 78883 mth2-5j2 01/13/05 |
| Mapped public sequence ID |
IMGAG|784.m00013 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tacattcatcataaatcatcccgagatcatgagtcctttggcaaagtggcacagattaaa
accaggcctgaccgaacgttttgaattgttcgtcaataagcatgaactttgcaacggcta
tactgaattgaatgatccagtagtgcaacgtcagagatttgc |