| Detail of Probeset Mtr.14428.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.14428.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|1115.m00011 /FEA=mRNA /DEF=Naringenin-chalcone synthase; Type III polyketide synthase AC146683.9.101 54170 52902 mth2-179n10 01/13/05 |
| Mapped public sequence ID |
IMGAG|1115.m00011 |
| Gene Ontology |
GO:0005575 GO:0008415 GO:0009813 GO:0016210 |
| KEGG |
K00660 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tggtcaccttcgagaagcaggactgacattccatctcctcaaggatgttcctggccttgt
ctcaaagaacattgagaaagctcttgttgaggcatttcagcctttgaatatctcggatta
caattccatc |