| Detail of Probeset Mtr.14567.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.14567.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|785.m00018 /FEA=mRNA /DEF=Heavy metal transport/detoxification protein; E1-E2 ATPase-associated region; Haloacid dehalogenase-like hydrolase; ATPase, E1-E2 type; Cadmium-transporting ATPase; Heavy metal translocating P-type ATPase AC125477.13.181 12 |
| Mapped public sequence ID | IMGAG|785.m00018 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | ttgtgatgccaatgcgaaaacctcaaaccttcatattgcagtcagaattgc |