Detail of Probeset Mtr.14567.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.14567.1.S1_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|785.m00018 /FEA=mRNA /DEF=Heavy metal transport/detoxification protein; E1-E2 ATPase-associated region; Haloacid dehalogenase-like hydrolase; ATPase, E1-E2 type; Cadmium-transporting ATPase; Heavy metal translocating P-type ATPase AC125477.13.181 12 |
Mapped public sequence ID |
IMGAG|785.m00018 |
Gene Ontology |
|
KEGG |
|
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
ttgtgatgccaatgcgaaaacctcaaaccttcatattgcagtcagaattgc |