| Detail of Probeset Mtr.14574.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.14574.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|718.m00003 /FEA=mRNA /DEF=t-snare; Syntaxin, N-terminal; Target SNARE coiled-coil region; Synaptobrevin AC087771.3.21 8784 12321 8D15 01/13/05 |
| Mapped public sequence ID | IMGAG|718.m00003 |
| Gene Ontology | GO:0005515 GO:0005768 GO:0016021 GO:0016079 GO:0016192 GO:0031201 |
| KEGG | K08488 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | ctttggcgtgcttgcttatggtgatatttgga |