Detail of Probeset Mtr.14609.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.14609.1.S1_at
Species Medicago truncatula
Annotation IMGAG|719.m00027 /FEA=mRNA /DEF=Cytochrome b/b6, C-terminal; Photosynthetic reaction centre protein cytochrome b6/f_IV AC093544.8.261 49207 48683 chloroplast 01/13/05
Mapped public sequence ID IMGAG|719.m00027
Gene Ontology GO:0003674 GO:0008150 GO:0009512
KEGG K02637
Transporter 3.D.3 3.E.2 3.D.3.2.1 3.E.2.2.2
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence atgtccggttctttcggaggatggatctataagaattcacctatcccaataacaaaa