| Detail of Probeset Mtr.14697.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.14697.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|758.m00020 /FEA=mRNA /DEF=Zinc-containing alcohol dehydrogenase superfamily; GroES-like; D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding AC123898.40.201 99051 101242 mth2-31m6 01/13/05 |
| Mapped public sequence ID |
IMGAG|758.m00020 |
| Gene Ontology |
GO:0004024 GO:0006113 GO:0008152 GO:0008270 GO:0016491 |
| KEGG |
K00002 K00095 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT47005 |
| Target sequence |
agatatgagggcgttggctaaatcattggattttataattgacacggcatcgggtgatca
cctgtttgatccttacatgtcacttctgaagatatctggtgttctggtcttagttgggtt
cccaagtgaagtcaaattcagccctgcaagccttaatttaggatcaagaactgt |
