| Detail of Probeset Mtr.14756.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.14756.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|762.m00006 /FEA=mRNA /DEF=Galactose mutarotase-like AC124214.8.51 32140 31967 mth2-36a23 01/13/05 |
| Mapped public sequence ID |
IMGAG|762.m00006 |
| Gene Ontology |
GO:0003674 GO:0005575 GO:0005634 GO:0005737 GO:0005975 GO:0008150 GO:0047938 GO:0016854 GO:0019318 |
| KEGG |
K01785 K18199 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
BI311593 |
| Target sequence |
gctttgtgtagatggtgcagttatagagaaacctgtgaacttgaagcctggagaggagtg
gacagggaggattcaactctcagttgtgcgatcaagtttttgtagtgaccgtctaggtct
cgacagaagtggtatttga |
