| Detail of Probeset Mtr.14779.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.14779.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|763.m00023 /FEA=mRNA /DEF=LQGC hypothetical protein AC124218.17.231 97927 98109 mth2-30b20 01/13/05 |
| Mapped public sequence ID |
IMGAG|763.m00023 |
| Gene Ontology |
GO:0003735 GO:0005730 GO:0005737 GO:0005829 GO:0006412 GO:0006414 GO:0022626 |
| KEGG |
K02894 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
ES611179 EX528492
|
| Target sequence |
aagggacttggagctgatttagtacgaaaatacgaagattcagagacaaaaatatgtctc
ccccaaagtcagaagcttggcacggcccgtgctagcattggcacagccgtgccaccctcc
agagtcacttttgctgcttttacttag |