| Detail of Probeset Mtr.14783.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.14783.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|721.m00002 /FEA=mRNA /DEF=O-methyltransferase, family 2; Generic methyltransferase; SAM (and some other nucleotide) binding motif AC119415.13.11 13817 6891 mth2-27n2 01/13/05 |
| Mapped public sequence ID | IMGAG|721.m00002 |
| Gene Ontology | GO:0005575 GO:0008150 GO:0008168 GO:0008171 GO:0019438 |
| KEGG | K00599 K05279 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | ALFSALMCAT DY617237 TCMT43196 |
| Target sequence | gaaaattcttgagacctacacaggttttgaaggccttaaatctcttgttgatgtaggtgg |