| Detail of Probeset Mtr.15007.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.15007.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|773.m00014 /FEA=mRNA /DEF=ARF/SAR superfamily; ADP-ribosylation factor; GTP-binding protein SAR1; Ras small GTPase, Rab type; Small GTP-binding protein domain; Ras GTPase AC124961.18.141 42338 43940 mth2-18l7 01/13/05 |
| Mapped public sequence ID | IMGAG|773.m00014 |
| Gene Ontology | GO:0005515 GO:0005794 GO:0042493 GO:0005525 GO:0015031 |
| KEGG | K07977 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT42581 CA922644 BT051729 AL375833 |
| Target sequence | gttgatagcaatgacagggaccgtgttgttgaggctagagatgagctgcacaggatgttg |