| Detail of Probeset Mtr.15033.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.15033.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|774.m00005 /FEA=mRNA /DEF=20S proteasome, A and B subunits AC124964.17.41 21589 13796 mth2-27c4 01/13/05 |
| Mapped public sequence ID | IMGAG|774.m00005 |
| Gene Ontology | GO:0004175 GO:0005634 GO:0005737 GO:0005829 GO:0005839 GO:0006508 GO:0006511 GO:0007346 GO:0008233 GO:0019774 GO:0043161 GO:0030163 |
| KEGG | K02735 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | CO516454 TCMT42407 TCMT42453 |
| Target sequence | catggttggcaagaattgcttcgccattgccagcgatcgaagactcggtgttcagcttca |