Detail of Probeset Mtr.15072.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.15072.1.S1_at
Species Medicago truncatula
Annotation IMGAG|727.m00013 /FEA=mRNA /DEF=Photosystem II reaction centre protein PsbD/D2; Photosynthetic reaction centre protein AC121235.20.121 58999 58082 mth2-21k24 01/13/05
Mapped public sequence ID IMGAG|727.m00013
Gene Ontology GO:0030096
KEGG K02706
Transporter 3.E.2 3.E.2.2.1 3.E.2.2.2
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence acctacgtgcctatgcagtggaaccggtagcccaacataattgcttcctacac