| Detail of Probeset Mtr.15268.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.15268.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|780.m00015 /FEA=mRNA /DEF=ADP-ribosylation factor; Ras small GTPase, Rab type; Ras small GTPase, Ras type; Ras small GTPase, Rho type; GTP-binding nuclear protein Ran; Ras GTPase; Small GTP-binding protein domain; Sigma-54 factor, interaction region |
| Mapped public sequence ID |
IMGAG|780.m00015 |
| Gene Ontology |
GO:0000331 GO:0005525 GO:0005575 GO:0007264 GO:0015031 GO:0016339 GO:0030036 GO:0031157 GO:0032794 GO:0033298 GO:0050708 |
| KEGG |
K07976 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
EX524529 TCMT49876
|
| Target sequence |
gttgtcttttattgcgtttctctgatgggtcttttacaactagttttatcacaaccattg
gcattgacttcaaaataaggacaattgagcttgatggaaagcgaatcaaattgcaaatat
gggacacagccggtcaagagcggtttcgaactatcacaactgcttactaccgtggagcca
tgggtattttgcttgtatatgacgttactgacgagtcttcttttaacaatatcaggaatt
ggattcgtaacattg |