| Detail of Probeset Mtr.15303.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.15303.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|735.m00003 /FEA=mRNA /DEF=Eukaryotic initiation factor 5A hypusine (eIF-5A); Translation protein SH3-like; Nucleic acid-binding OB-fold; KOW AC122160.21.31 14097 11848 mth2-23d6 01/13/05 |
| Mapped public sequence ID | IMGAG|735.m00003 |
| Gene Ontology | GO:0003723 GO:0003743 GO:0005515 GO:0005737 GO:0005739 GO:0005840 GO:0006413 GO:0006417 |
| KEGG | K03263 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40748 TCMT40941 TCMT40819 TCMT41338 |
| Target sequence | gatgccggagcatccaaaacctatcctcaacaggccggtactattcgcaagaatggttac |