Detail of Probeset Mtr.15310.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.15310.1.S1_at
Species Medicago truncatula
Annotation IMGAG|735.m00009 /FEA=mRNA /DEF=Fatty acid desaturase; Fatty acid desaturase subdomain AC122160.21.91 54702 48966 mth2-23d6 01/13/05
Mapped public sequence ID IMGAG|735.m00009
Gene Ontology GO:0004768 GO:0005789 GO:0006633 GO:0016021
KEGG K10255
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database TCMT52862  TCMT52861  
Target sequence cacttctggatgagcactttcaccatggtgcatcatact