| Detail of Probeset Mtr.15323.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.15323.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|736.m00004 /FEA=mRNA /DEF=Phosphate permease; General substrate transporter; Major facilitator superfamily MFS_1 AC122161.26.41 23415 25016 mth2-11l3 01/13/05 |
| Mapped public sequence ID | IMGAG|736.m00004 |
| Gene Ontology | GO:0005215 GO:0005315 GO:0005384 GO:0005887 GO:0006797 GO:0006810 GO:0006817 GO:0006828 GO:0006944 GO:0009451 GO:0016021 GO:0016072 GO:0042254 |
| KEGG | K08176 |
| Transporter | 2.A.1 2.A.1.9 2.A.1.9.1 2.A.1.9.3 2.A.1.9.2 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40628 TCMT55784 EF016358 TCMT55783 |
| Target sequence | aatgcaattcatgaggtttacaagattgcaagagcacaaacacttattgcgttgtgcagt |