| Detail of Probeset Mtr.15340.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.15340.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|736.m00021 /FEA=mRNA /DEF=Malate dehydrogenase, active site; Malate dehydrogenase, NAD or NADP; Malate dehydrogenase, NAD-dependent, cytosolic; Lactate/malate dehydrogenase AC122161.26.211 76656 81200 mth2-11l3 01/13/05 |
| Mapped public sequence ID | IMGAG|736.m00021 |
| Gene Ontology | GO:0004470 GO:0005829 GO:0030060 |
| KEGG | K00026 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40542 TCMT52604 BF644947 |
| Target sequence | aattcgctccatctattccagaaagaaacatttcttgtttgactagactggatcacaata |