| Detail of Probeset Mtr.15357.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.15357.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|783.m00018 /FEA=mRNA /DEF=probable Ta11-like non-LTR retroelement protein [imported] - Arabidopsis thaliana AC125474.16.181 85678 84137 mth2-16l11 01/13/05 |
| Mapped public sequence ID |
IMGAG|783.m00018 |
| Gene Ontology |
GO:0000739 GO:0003677 GO:0003845 GO:0005496 GO:0005507 GO:0005515 GO:0005524 GO:0005634 GO:0005730 GO:0005737 GO:0005739 GO:0005789 GO:0005791 GO:0005792 GO:0006289 GO:0006694 GO:0006704 GO:0006713 GO:0006915 GO:0007275 GO:0007569 GO:0008152 GO:0008635 GO:0016491 GO:0030308 GO:0030324 GO:0031965 GO:0043456 GO:0045177 GO:0050661 |
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tgccagttactacagcagggaccctgcatcttgcggatcagcagcgtccttcacagcagc
agccagttcaggtccccgttcctcatgacgcttcattcccaacggaaaaggatcaagaat
cagaacgtgcaaatctgattgataatatctctattgatcaacaggaaattgttactgtgg
aggaggaaatttcagctgcacagtttaatgtagctactactaatttggagcagctttctg
attctccggttcagc |