| Detail of Probeset Mtr.15376.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.15376.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|784.m00002 /FEA=mRNA /DEF=SAM (and some other nucleotide) binding motif AC125475.11.11 6509 2526 mth2-5j2 01/13/05 |
| Mapped public sequence ID | IMGAG|784.m00002 |
| Gene Ontology | GO:0005575 GO:0008757 |
| KEGG | K00599 K13473 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT50595 |
| Target sequence | gagggtgatcttttactcagtgacatgggtcagggtttagggcttcgtcctggagttatt |