| Detail of Probeset Mtr.15473.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.15473.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|742.m00002 /FEA=mRNA /DEF=Amino acid/polyamine transporter II AC122169.23.11 4547 9560 mth2-9m5 01/13/05 |
| Mapped public sequence ID |
IMGAG|742.m00002 |
| Gene Ontology |
GO:0000324 GO:0000329 GO:0005215 GO:0005302 GO:0006865 GO:0007034 GO:0015186 GO:0015188 GO:0018193 GO:0018991 GO:0040011 GO:0005280 GO:0005764 GO:0006836 GO:0015180 GO:0015187 GO:0015193 GO:0015495 GO:0015808 GO:0015816 GO:0015824 GO:0015992 GO:0016021 GO:0060077 |
| KEGG |
K18413 K18659 K21749 |
| Transporter |
2.A.18 2.A.18.5.1 2.A.18.5.2 2.A.18.8.1 2.A.18.8.2 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT58580 |
| Target sequence |
tgttttgccggtgtttttatatggaagcgtcggagctgcgggatttcttatgtttggcga
aaggacttcatctcagataacattggatctaccacgagatgcatttgcttccaaagtctc
cttgtggactataatggataacatgtctgtgacatcttttgttacaatttcagggctagt
gatggctttaattggttctctcctcagtgtacttgtggcaatggttttgccagctttttg
ttttctgaaaattgt |
