| Detail of Probeset Mtr.15525.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.15525.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|745.m00001 /FEA=mRNA /DEF=Dynein light chain, type 1 AC122722.6.11 2603 2057 mth1-3f12 01/13/05 |
| Mapped public sequence ID |
IMGAG|745.m00001 |
| Gene Ontology |
GO:0000003 GO:0002009 GO:0002119 GO:0005515 GO:0009792 GO:0010171 GO:0035046 GO:0040010 GO:0040011 GO:0040035 |
| KEGG |
K10418 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
aacagatatgcctttgaagatgcaaattcaagctatgtcatatgcttctcaagcccttga
tctctatgatgtgtgtgattgtagatcaattgctggttatatcaagaa |