Detail of Probeset Mtr.15539.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.15539.1.S1_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|745.m00018 /FEA=mRNA /DEF=Ras GTPase; Ras small GTPase, Ras type; Ras small GTPase, Rab type; Ras small GTPase, Rho type; GTP-binding nuclear protein Ran; Small GTP-binding protein domain AC122722.6.181 90067 86867 mth1-3f12 01/13/05 |
Mapped public sequence ID |
IMGAG|745.m00018 |
Gene Ontology |
GO:0003924 GO:0005515 GO:0005525 GO:0005624 GO:0005737 GO:0005829 GO:0006897 GO:0006928 GO:0006935 GO:0006972 GO:0007010 GO:0007155 GO:0007264 GO:0007411 GO:0007520 GO:0008283 GO:0016023 GO:0016358 GO:0016477 GO:0016601 GO:0019897 GO:0019899 GO:0021799 GO:0021831 GO:0030027 GO:0030032 GO:0030036 GO:0030334 GO:0030742 GO:0030838 GO:0042995 GO:0043552 GO:0045453 GO:0045740 GO:0051668 GO:0060263 |
KEGG |
K04392 K07975 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT50292 |
Target sequence |
gttcttgttggcacaaagttggatcttcgtgaagatcgtggatatttcgctgatcacacg
ggatataatgttataacatctgctgagggagaagaact |