| Detail of Probeset Mtr.15684.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.15684.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|749.m00011 /FEA=mRNA /DEF=LQGC hypothetical protein AC122728.32.111 26536 27330 mth2-22l4 01/13/05 |
| Mapped public sequence ID |
IMGAG|749.m00011 |
| Gene Ontology |
GO:0005515 GO:0005737 GO:0005829 GO:0006378 GO:0008022 GO:0008143 GO:0008494 GO:0048255 |
| KEGG |
K19472 K19652 K19717 |
| Transporter |
|
| Transcription Factor |
C3H |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ctcggatacaactcaaatgcaagggcaatcaagaacagcaacaagaacagcccatgcctc
ctattacgagtcagaacagcgacgatctcatgtttggcaacatgtctatggcggcggacc
gccggtacaatgaatttatgaggtttgatcggcaaa |
