| Detail of Probeset Mtr.15696.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.15696.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|797.m00015 /FEA=mRNA /DEF=LQGC hypothetical protein AC126012.22.151 78450 78811 mth2-27p4 01/13/05 |
| Mapped public sequence ID |
IMGAG|797.m00015 |
| Gene Ontology |
GO:0005515 GO:0005634 GO:0005847 GO:0006378 GO:0006379 |
| KEGG |
K11422 K21919 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tttgtgtaaacactgcattctgcccgagccaaagttcatcgctcgccacgcgagttacaa
gttgtagctcgccacggcgagcaaccctactcgccatagcgagcttgaccagtgaacatg
gaatgattcagaacgagtttgaacctgaaacaaccttagttggaattctggcttgtact |
