| Detail of Probeset Mtr.15800.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.15800.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|802.m00016 /FEA=mRNA /DEF=Ubiquitin interacting motif; Zn-binding protein, LIM; Peptidase M, neutral zinc metallopeptidases, zinc-binding site; Immunoglobulin/major histocompatibility complex AC126779.18.161 103488 98597 mth2-34m14 01/13/05 |
| Mapped public sequence ID |
IMGAG|802.m00016 |
| Gene Ontology |
GO:0000131 GO:0001756 GO:0005515 GO:0005737 GO:0005933 GO:0005934 GO:0005935 GO:0007507 GO:0030011 GO:0043332 |
| KEGG |
K07520 |
| Transporter |
|
| Transcription Factor |
LIM |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
accgagtcacagacatgataaccaagccttatagactgacccgtcgatgcgaagtgacgg
ccattcttgttttgtatggccttcctagattgttgacaggatcaatcctagctcatgaga
ttatgcatgcatggctcaggcttaaaggttatcccaacttgaggccaga |