Detail of Probeset Mtr.15800.1.S1_s_at in Chip AffyMedicago
Probeset ID Mtr.15800.1.S1_s_at
Species Medicago truncatula
Annotation IMGAG|802.m00016 /FEA=mRNA /DEF=Ubiquitin interacting motif; Zn-binding protein, LIM; Peptidase M, neutral zinc metallopeptidases, zinc-binding site; Immunoglobulin/major histocompatibility complex AC126779.18.161 103488 98597 mth2-34m14 01/13/05
Mapped public sequence ID IMGAG|802.m00016
Gene Ontology GO:0000131 GO:0001756 GO:0005515 GO:0005737 GO:0005933 GO:0005934 GO:0005935 GO:0007507 GO:0030011 GO:0043332
KEGG K07520
Transporter
Transcription Factor LIM
Mapped unigene in the TRICHOME database N/A
Target sequence accgagtcacagacatgataaccaagccttatagactgacccgtcgatgcgaagtgacgg
ccattcttgttttgtatggccttcctagattgttgacaggatcaatcctagctcatgaga
ttatgcatgcatggctcaggcttaaaggttatcccaacttgaggccaga