| Detail of Probeset Mtr.15849.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.15849.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|848.m00008 /FEA=mRNA /DEF=glycine-rich RNA binding protein-related AC134242.17.81 30780 30935 mth2-10p20 01/13/05 |
| Mapped public sequence ID |
IMGAG|848.m00008 |
| Gene Ontology |
GO:0005515 GO:0006412 GO:0009409 GO:0035196 GO:0043023 GO:0005575 |
| KEGG |
K02965 K11294 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT42315 TCMT42508
|
| Target sequence |
agccttctctcaatacggcgagatcgttgattccaaggtccgtttgttgcttgcaggc |
