| Detail of Probeset Mtr.15903.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.15903.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|849.m00024 /FEA=mRNA /DEF=Plant invertase/pectin methylesterase inhibitor; Pectinesterase; Pectinesterase inhibitor; TonB box, N-terminal; Pectin lyase-like AC134522.241 104027 101988 AC126017.7 01/13/05 |
| Mapped public sequence ID |
IMGAG|849.m00024 |
| Gene Ontology |
|
| KEGG |
K01051 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
catcaattcaaaggctgcacataggtttgcaccatccaagttcttccatggtggtgactg
gattaaggacactggaattccttactttccaactatacctgaacacaagaagcacaa |
