| Detail of Probeset Mtr.16120.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.16120.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|815.m00007 /FEA=mRNA /DEF=LQGC hypothetical protein AC127020.15.61 14121 14282 mth2-9p1 01/13/05 |
| Mapped public sequence ID |
IMGAG|815.m00007 |
| Gene Ontology |
GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0004601 GO:0009533 GO:0009535 GO:0016688 GO:0020037 GO:0003824 GO:0008150 GO:0008270 |
| KEGG |
K00140 K00430 K01487 K01493 K04120 K07384 K07385 K07497 K09873 K15001 K22300 |
| Transporter |
|
| Transcription Factor |
LIM WRKY |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
ttttgcttctgatgaccttctacttctgatgacgtcatctcttcaggagcagtttagctt
caggagcagtttagcttcaggagcagttttcttcagatgcttagaatttctttttct |