| Detail of Probeset Mtr.16210.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.16210.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|861.m00012 /FEA=mRNA /DEF=hypothetical protein AC135232.18.111 75916 75556 mth2-10k13 01/13/05 |
| Mapped public sequence ID |
IMGAG|861.m00012 |
| Gene Ontology |
GO:0000166 GO:0004748 GO:0005515 GO:0005737 GO:0005971 GO:0006260 GO:0006974 GO:0009186 GO:0009263 |
| KEGG |
K10807 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tgatactttctgattgccataataagtttttcggaaacttatggtttaatttcgttagtg
tgaggatgatttgtccgtggacgtttttgggtcctccgccggagccaacccccgccgcag
gaaaatcttttgtccaagcagtaactaacacatgggtcagaaaatctggtgatt |