Detail of Probeset Mtr.16346.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.16346.1.S1_at
Species Medicago truncatula
Annotation IMGAG|867.m00002 /FEA=mRNA /DEF=Prefoldin AC135320.6.11 16341 22901 mth2-28e9 01/13/05
Mapped public sequence ID IMGAG|867.m00002
Gene Ontology GO:0000089 GO:0000775 GO:0000940 GO:0001932 GO:0003777 GO:0003779 GO:0005515 GO:0005634 GO:0005783 GO:0005794 GO:0005829 GO:0005886 GO:0006275 GO:0007079 GO:0007080 GO:0008017 GO:0016044 GO:0016477 GO:0030027 GO:0030032 GO:0031410 GO:0032148 GO:0032956 GO:0035091 GO:0042127 GO:0042803 GO:0043422 GO:0043515 GO:0051382
KEGG K02331 K11498 K11499
Transporter
Transcription Factor bHLH
Mapped unigene in the TRICHOME database N/A
Target sequence catgaaccattatctgcgccaacagtggaccatgctatgatatgccatcgttcagatgat
tcaggaagatatctaaattactcctcagaattggacatag