Detail of Probeset Mtr.16363.1.S1_s_at in Chip AffyMedicago |
Probeset ID |
Mtr.16363.1.S1_s_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|868.m00002 /FEA=mRNA /DEF=LQGC hypothetical protein AC135396.30.21 8440 9117 mth2-33o18 01/13/05 |
Mapped public sequence ID |
IMGAG|868.m00002 |
Gene Ontology |
GO:0003674 GO:0008150 GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0008152 GO:0016208 |
KEGG |
K00520 K00666 K07497 |
Transporter |
9.B.27.1.1 9.B.27.1.2 9.B.17.1.4 9.B.17.1.6 |
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT56752 EX529444
EX527521 EX530106
EX528719 |
Target sequence |
cttcggtattggcacatgtgataaccccactcaacggagg |